| splitseq {seqinr} | R Documentation |
Split a sequence into sub-sequences of 3 (the default size) with no overlap between the sub-sequences.
splitseq(seq, frame = 0, word = 3)
seq |
a vector of chars |
frame |
an integer (0, 1, 2) giving the starting position to split the sequence |
word |
an integer giving the size of the sub-sequences |
This function returns a vector which contains the sub-sequences.
J.R. Lobry
citation("seqinr")
cds <- s2c("aacgttgcaggtcgctcgctacgtagctactgttt")
## To obtain the codon sequence in frame 0:
splitseq(cds)
## Show the effect of frame and word with a ten char sequence:
(tenchar <- s2c("1234567890"))
splitseq(tenchar, frame = 0)
splitseq(tenchar, frame = 1)
splitseq(tenchar, frame = 2)
splitseq(tenchar, frame = 0, word = 2)
splitseq(tenchar, frame = 0, word = 1)