SeqFastadna              package:seqinr              R Documentation

_C_l_a_s_s _f_o_r _D_N_A _s_e_q_u_e_n_c_e _i_n _F_a_s_t_a _F_o_r_m_a_t

_D_e_s_c_r_i_p_t_i_o_n:

     'as.SeqFastadna' is called by many functions as 'read.fasta'. It
     creates an object of class 'SeqFastadna'.  'is.SeqFastadna'
     returns TRUE if the object is of class 'SeqFastadna'. 
     'summary.SeqFastadna' gives the base composition of an object of
     class 'SeqFastadna'.

_U_s_a_g_e:

     as.SeqFastadna(object, name = NULL, Annot = NULL)
     is.SeqFastadna(object)
     summary.SeqFastadna(object,...)

_A_r_g_u_m_e_n_t_s:

  object: a vector of chars representing a biological sequence

    name: 'NULL' a character string specifying a name for the sequence 

   Annot: 'NULL' a character string specifying some annotations for the
          sequence 

     ...: additional arguments affecting the summary produced

_V_a_l_u_e:

     'as.SeqFastadna' returns an object sequence of class
     'SeqFastadna'. 'summary.SeqFastadna' returns a list which the
     following components: 

  length: the legth of the sequence

   compo: the base counting of the sequence

      GC: the percentage of G+C in the sequence

_A_u_t_h_o_r(_s):

     D. Charif

_R_e_f_e_r_e_n_c_e_s:

      'citation("seqinr")'

_E_x_a_m_p_l_e_s:

      s = read.fasta(system.file("sequences/malM.fasta",package="seqinr"))
      is.SeqFastadna(s[[1]])
      summary(s[[1]])
      myseq = s2c("acgttgatgctagctagcatcgat")
      as.SeqFastadna(myseq, name = "myseq", Annot = "blablabla")
      myseq

